Ice Spike Revisited; and the Welsh Historic Snowdrop Hunt.

After the excitement, for me, and the interest from readers in the ice spike featured in my previous post, I thought I’d write a little more about these unusual natural phenomena.SDIM5387 (2)

Ice spikes, or my earlier ice vase, below, from 2013, can only form because of the very unusual property of water that, as a liquid, it expands as it freezes. Few other materials in nature do this. Bismuth and Antimony, two related metals, also have this unusual property, but we’re unlikely to be able to study spikes with these, since their ‘freezing’ points are 272 and 631 degrees C respectively!SDIM6656 (2) 

Two American physicists, Liu and Libbrecht, (L&L) working at the California Institute of Technology in 2003, studied the creation of smaller artificial ice spikes in freezer ice cube trays of water, and concluded that the probability of spikes ever developing is most likely around minus 7 degrees C, and is also more likely if using impurity free distilled water, and ideally with some air movement above the tray in order to speed cooling.  Click here for their study. By filming inside their freezer, they established that the quite tiny ice cube spikes grew to their maximum heights surprisingly quickly, in between 3 to 10 minutes.S1040012 (2)

Close neighbours to us, had measured the minimum temperature on the night when our spike formed as being about the same ‘magic’ minus 7 degrees C. Under such suitable ‘supercooling’ conditions, where the temperature falls very rapidly at dusk, ice crystals which are classically hexagonal in profile, will begin form in a particular way, both spreading rapidly across the water surface and also around the base of a suitable water filled receptacle – the tarpaulin with us. The complete ice structure removed from the tarpaulin, below, gives an idea of how shallow the water pool was, and the length of the spike – estimated at about 190 mm.SDIM5389 (2)In addition, the ice crystals will grow down into the water, hanging like curtains, and also grow up from the base like walls. Depending on the angle these crystals start out at, they will probably not form vertically within the main body of water.S1040011 (2)

It’s been noticed that natural ice spikes like mine, and ice vases, usually have a triangular base, as in the case of my ice spike photographed from the tip down towards its base (above). This is probably because the hexagonal ice crystallites will eventually all tend to join together. If this process were as well controlled as with the efficiently constructed hexagonal wax cells in a honeybee hive, there would be no gaps between crystals. S1000003a (2)However, since ice crystal formation is a more random affair, then the potential for occasional triangular gaps to be created in the surface crystal sheet exists. At some point, under optimum conditions, the pressure of the encroaching ice crystals on the still cooling, but critically, expanding, unfrozen water below the surface, might force some of it out through just such a triangular gap.S1000006a (2)

The water will then start to freeze on contact with the colder air, but if the water is being forced out fast enough, this process can fairly quickly lead to a growing spike, or vase with peripheral walls, and a central water filled channel. Constantly extending at its tip, until either the water in the central channel freezes, blocking further water flow up it, or the supply of still liquid water in the centre of the ever thickening, ice lined ‘bowl’ is exhausted. L &L’s paper has a simple diagram illustrating this process, known as the Bally-Dorsey model, named after the two, independent scientists, who first proposed this explanation in the early 1900’s. L&L also suggest that water impurities impair ice spike formation, because they aren’t incorporated into the ice crystal lattice formation, so will tend to concentrate in the water droplet at the tip of the growing spike. In so doing, they will lower this bit of water’s freezing point, causing the spike to grow so slowly that water will freeze over completely lower down in the tube structure, before it spills out from the tip, and halt the spike growth process.S1040019 (2)

So, there you have it!

At last, I think I can really grasp how these amazing and rare structures form, and I hope that I’ve been able to explain it to any readers, in a more comprehensible way than last time. This now presents the new challenge of setting up several suitable, rain water filled containers, (and presumably our Welsh rain is wonderfully pure) in advance of any future predicted temperature plunges, and then making regular visual checks of the freezing surfaces, in order to allow the possibility of filming the growth of a natural spike, should it begin to form. Liu and Libbrecht reckoned about 50 micrometres of ice spike growth per second, so the whole process of spike formation is probably over surprisingly quickly. By my reckoning, this would equate to only about an hour for a spike, like this one, of 190 mm. How extraordinary!

I’m certainly up for another ice challenge. But we’d need some more proper winter weather to ever confirm this.SDIM0299 (2)

And need to wrap up well.SDIM8986 (2)

So for any other readers who live in a suitable climate, there’s a challenge too. And to any academics, how about creating a mathematical formula, or computer model to explain with more accuracy, the variables which are critical for allowing such amazing structures to appear?S1040144a (4)

Meanwhile, I’m now officially launching my Welsh Historic Snowdrop Hunt, (WHSH), after a trip to the National Botanic Garden of Wales (NBGW) this last weekend for another look at their ‘drops, and more particularly to hear Naomi Slade give a talk about designing with snowdrops in gardens.S1040138 (2)

Naomi has quite recently written a book, inspired by a long term love of these tiny white flowers – “The Plant Lover’s Guide to Snowdrops”. Beautifully illustrated, and full of interesting information, its other big selling point is that it describes the featured snowdrop cultivars according to both flowering season, and garden worthiness, which are two of the most critical parameters for anyone considering adding to, or even beginning, a snowdrop collection in their garden.S1000008 (2)

A couple of points raised during the talk, and Q and A afterwards, convinced me that I should ‘go public’ with my fledgling Welsh Historic Snowdrop Hunt (WHSH). Several observations I’ve made over recent years are pertinent to this project:

Firstly, many local Welsh ‘naturalised’ snowdrops are often early, and vigorous. This made an immediate impression on me back in the early 1990’s when we started to travel down from Bristol in late winter – the Welsh snowdrops were always bigger and more precocious than their Gloucestershire cousins.SDIM6069 (2)

Was this just because of local conditions, or were they genuine ‘good doers‘? It turned out that when our first snowdrops were moved from Bristol to Wales, they still lagged the indigenous ones in time of flowering and size.

Many local colonies are also clearly very prolific seeders, spreading in areas with no helping hand from any gardener. Indeed often thriving on neglect.SDIM6063 (2)

Secondly, in spite of there being nearly 2,500 named cultivars, none have, as far as I know at this time, genuine Welsh provenance. (E.O.A.) Why is this?

There is G. ‘Welshway’, but this was named after a house near Cirencester. Then there is the lovely G. ‘Mrs. McNamara’, which we grow, and which is named after Dylan Thomas’ mother-in-law. But taken from her garden in Hampshire, and possibly directly imported from overseas to grow there. Many snowdrops are from much drier parts of the UK, and some even from overseas. Most of the named cultivars will be just seedlings – natural or artificially created hybrids of species growing close to each other, or even single species variants. Perhaps some are even spontaneous mutations.SDIM5477 (2) Many are excellent garden plants, like G. ‘Atkinsii’, above but probably just as many are much more fussy, and struggle to survive or flourish here in our garden in West Wales. This is no doubt in part due to our much higher rainfall – a lot of named cultivars originate in East Anglia, for example, which receives about a quarter of our annual precipitation – currently around 2100 mm per annum, with consequences for the landscape as below. The Tywi river/lake at Dryslwyn after storm Gertrude last week, below.S1040137 (2) Several tried here – G. “Diggory”, G. “Clare Blakeway-Philips”, G .”Faringdon Double”, are lost without trace, or sulk and hardly increase in numbers -G. “Three Ships”, G. “Anglesey Abbey”. Such variety and fussiness inevitably present a great marketing opportunity for avid collectors and the supplying nurseries.S1040146 (2)

Thirdly, the origin of snowdrops in Britain is murky. Britain has a generally sparse native flora, compared with continental Europe, the Caucuses and Western Asia where most snowdrop species originate, following losses of much flora during the last Ice Age. Click here for some fascinating maps of where the ice coverage extended to, and how it retracted as the climate warmed. So, it’s imagined that snowdrops were brought (back?) into Britain, maybe by the Romans, maybe by the Normans. Wales had its own very special links both with Ireland to the west over thousands of years; with the Romans during their conquest in AD 43 -84 (click here) in Britain, although West Wales was inevitably one of the last areas to be reached; and then with Europe more generally through the monasteries, abbeys and the centre of mediaeval medicine associated with the local physicians of nearby Myddfai during the early middle ages. Click here, here, here and here for some examples.

Fourthly, from my observations of flowering snowdrops, there are real issues with pollination, and seed formation. Temperature and rainfall, certainly in West Wales present problems with the number of potential insect pollinators around at snowdrop flowering time. In our garden, early cultivars’ flowers often contain tiny flies, little larger than midges.SDIM7182 (2) (And now you will notice a trick gleaned from Naomi’s talk – a tiny Christmas Cracker mirror, about to be chucked out, and taped to a stick is really handy at looking up inside snowdrop flowers, to see if there are any insects present – without disturbing them).SDIM5444 (2) Are they there because the flower is a dry, and probably warmer, refuge?SDIM5457 (2) I’ve previously measured 2 degree C temperature differences within snowdrop flowers, compared to the outside ambient temperature. So they may well be thermogenic, as part of their strategy to attract early season insects for pollination purposes.SDIM5442 (2) I’ve also occasionally found Hebrew character moths, Orthosia gothica, resting at night  inside the flowers, later in the season.SDIM0774 (2)

If you’re lucky enough to have a nearby honeybee hive, then the bees love visiting the open flowers, and avidly collect the pollen. But at this time of the year, honeybees won’t be able, or willing, to fly long distances to seek out a snowdrop population. We haven’t seen any yet in the garden this year, but now have well over 100 types of snowdrops in flower.SDIM8006 (2)Finally, in our garden, overwintered bumblebee queens rarely emerge from hibernation before the middle, to end, of February. Too late for many snowdrops, but even with masses of Galanthus nivalis flowers available every year, I’ve only ever seen a single bumblebee bother to visit them, shown below.2014-03-17 All this means that snowdrop colonies anywhere tend to be quite discrete, almost ‘island‘ communities, rarely running from one property to the next, in a way that many common ‘native‘ wild flowers do.

Fifthly, our part of Wales had large numbers of historic houses, many of which were built around the late 1700’s/early 1800’s. At the time, the most commonly available species of snowdrop in the UK was the familiar single ‘native’ Galanthus nivalis, (although there are some herbal records of G. plicatus being present from the 1600/1700’s), and the ‘native’ double form of G. nivalis flore pleno, which was first recorded in the UK in 1703. Since this seems sterile, at least as far as seed production is concerned, with vestigial ovaries, it could only have been spread by bulb movements. However, its double flowers are clearly also visited by the tiny flies, (3 below), so could act as a potential pollen source for pollinating single G. nivalis.SDIM5446 (2) But there is still huge variability possible within the single form of G. nivalis, judging by the number of available forms of it grown, and illustrated, on the ‘Judy’s Snowdrops’ pages. Click here for more. Many of the local grand historic houses would have had gardens planted up originally by the first generation of enthusiastic new occupants. They wouldn’t have had access to the more exotic species like G. elwesii, introduced much later towards the 1860’s/1870’s.SDIM5430 (2)

But huge numbers of these houses are no more. There is a wonderful website, a real labour of love, created by locally based photographer Paul White, who has spent over 25 years cataloguing some of these grand, and also not so grand Welsh houses, and their fall from grace, into dereliction. Paul won’t allow direct links onto his site (for security reasons, I guess), but do google “Paul White Welsh Ruins” and have a look. A couple of our now revered local gardens at Aberglasney, and indeed the NBGW fell into this category of property, but have been brought back from the brink, and have had wonderful gardens recreated.  No such luck, for example, at Derry Ormond just North of Lampeter, where the ornate gates, outbuildings and folly tower survive, but the huge main house was demolished in the 1950’s. Click here to see what it looked like. I have no idea whether snowdrops linger on within the grounds, out living the men, women and masonry of the 19th and early 20th centuries.S1040004 (2)S1040006 (2)

Sixthly, and finally, the ‘hunt’s’ aim is to visit some of these properties, and, if possible, with permission, to photograph and collect some small representative samples of their local ‘island’ snowdrops population, and grow them alongside our modest collection of named cultivars to see how they perform for vigour, flower production and fecundity – seed formation. In time I would love to be able to persuade an interested student to DNA profile some of these Welsh historic origin snowdrops, to work out whether there are any common genealogies, which would allow possible origins or sources of plants to be explored.SDIM5463 (2)

I have already made some enquiries, put out some feelers, and the first visits are planned. Readers may know that the NBGW was the first to DNA barcode the entire native Welsh flora. There are apparently 10 examples of individual G. nivalis snowdrops from around the world which have already been coded in this way, though frustratingly, I can’t find the specific Welsh record. What does a barcode look like though? This hidden code of life for the humble snowdrop? Courtesy of the excellent BOLD (Barcode Of Life Data system) website, the code for a single snowdrop is shown below – addendum -sadly I can no longer access this website. (It’s recorded as being supplied by one A.P. Davis, who I’m guessing may be Aaron Davis, one of the co-authors of the very detailed multi-author book on snowdrop identification – “Snowdrops – A Monograph of Cultivated Galanthus” 

In Letter code: (the letters stand for the 4 nucleic acids that form the basic building blocks of all genes – Cytosine, Adenine, Thymine and Guanine. Click here for more on the basic theories and limitations of DNA bar coding for life forms).

CTATTGACGCTCTCTGCCTTTTGCAATTTCATGTCTTGCGATTAGACATTAGGTATTGATGTGGAGATTGCCCCC
CTCCTCATACATCATTAGGTGGTGGGTCTAATTGTTAGTTGTCGATCGTGATGGACGTGGCGAGAGGAGTTTTGA
CACACATTCTATCATGGAAGTAACTTAGCTTGGGTGACGCACCGGAGTAACCTATGATAATTGGTGACATGTGAG
TATTACTTGGAACATGACCCCAGGTCAGGTAGGGTCACCTGCTGAGTTTAAGCATATCA
Illustrative Barcode:
 

Eventually, perhaps some of these local and historic forms of Welsh snowdrops may find wider use, as garden plants honed over the centuries to cope with the soils, climate, and rainfall of the Western fringes of the UK, and attractive to the few pollinators available in late Welsh winters. And will meantime grow comfortably in the environs of this once derelict, memory infused place, bringing their own magic with them.S1040001 (2)

Perhaps someone might even be able to study fungal root associations with snowdrop bulbs, since such symbiosis is likely to be critical to the success of this type of bulb in any given location. In the future, even nerdier galanthophiles may be able to scan bar codes of bulbs before shelling out hundreds on the latest new thing, or ‘breeders/nurserymen’ may even be able to predict, from reading the detailed barcode of a new seedling, just what it might look like, way before it’s grown to flowering potential – it can take 5 years from seed to new flower.

Probably all fantasy, and certainly for the average gardener like me, who simply wants bulbs that grow, thrive and delight at this grey time of year, an irrelevance.S1040147 (2)

The hunt will no doubt last many years, but in time I hope I can provide a few updates as to how it’s progressing. I am already very grateful to the people who have so far agreed to help me in this task, and been very generous with their time and advice. And if any readers know of any local ‘naturalised’ populations which might fit into the categories of being ancient, vigorous and floriferous, and which they think should be included in the project, do get in touch.

At the time of writing this, February1st/2nd, we’re at the date of the old Celtic festival of spring – Imbolc, or as it was known in Wales, Gŵyl Fair y Canhwyllau. Click here for more. The day that it was deemed to be light enough to dispense with candles for illuminating the livestock, at feeding time. How they coped without electricity is beyond me – we’ve resorted to my old SAD light box being switched on at mealtimes, after this gloomiest of winters, to help to reduce the melatonin influence, and aid sleep. It seems to be working, just as Galanthus ‘Imbolc’, a snowdrop originally from Oxfordshire, emerges spot on time, for once.SDIM5439 (2)And remarkably, from the still soggy garden, a few pictures of other early flowers, prompted by the mild conditions to peek out, grow fast, and then flop over in the rain.SDIM5409 (2)SDIM5423 (2)SDIM5413 (2)SDIM5424 (2)SDIM5417 (2)SDIM5420 (2)The above image shows the extremely odd mix of Crocus flowers fully opened under such poor light, but mild, conditions typical of early 2016. the light was so poor that the exposure was at  maximum aperture of f1.8, and a thirtieth of a second at 200 ASA, for the photographers out there.

24 thoughts on “Ice Spike Revisited; and the Welsh Historic Snowdrop Hunt.

  1. Your garden is so beautiful. Do you mean that you have 100 different snowdrop cultivars in bloom?

    I am beginning to question the assertion that a particular snowdrop is fussy. I planted 2 Wendy’s Gold in my rock garden 10′ apart in 2011. One plant is now three and struggles, the other has 12 flowers this year. With an expensive bulb like WG, I (and most collectors) would have purchased one (a nice gardening friend gave them to me). Had I planted it in the first location, I would be telling you it was hard to grow. And because there are so many snowdrop cultivars that I want, I would not have purchased another and tried it somewhere else or even moved it. The only difference between the two spots is that the difficult spot gets more sun.

    I live in the gardener’s cottage on an old estate, and G. nivalis covers the property by the thousands. They multiply and multiply, but I have never seen a seedling and believe they multiply through offsets. All the plants look identical. I am told that this is true for most G. nivalis in the US.

    I never could find any evidence that snowdrops are thermogenic. I think that’s how you and I “met'” :-).

    • Hello Carolyn, and thanks for the comment, which touches on a number of points.
      By now we’ve probably added another 20 or so to the 100 mark in flower – mainly because I’ve consciously chosen quite a lot of early flowering snowdrops, and this year, many are weeks earlier than normal. Needless to say we only have ones or twos of many cultivars for now.
      Re the fussiness point, you could indeed be right .., and your choice is interesting – we have Wendy’s Gold in 2 places and its sluggish in both, compared to the yellow Spindlestone Surprise, which does well in both places. But they also are of different origins. I’m also a little wary of assuming that the only difference is the amount of sunshine at both locations. I’ve yet to read a good article on mycorrhizal associations with snowdrop roots, but I do remember reading that English Bluebells with a broadly similar root structure and habit of enjoying woodland conditions can have associations with 11 different fungi – which are necessary for optimal growth. So I wonder whether how particular snowdrops perform in particular locations isn’t affected by what (hidden) fungi are lurking unseen beneath the soil.
      Re. nivalis seeding around, it’s certainly the case that here, as I tried to illustrate with the pics, pollinators are few and far between. And favourable conditions for natural pollination may only occur in some years. But last year for example, we had some mild sunny weather, a honey bee hive on site, numerous bee-flower visits, and this year you can find quite a lot of seedling nivalis, close to and between the existing clumps – though you have to look quite hard – they’re a brighter green than the normal mature nivalis leaf. Certainly round here as well, although the green markings on nivalis forms are fairly similar, flower size, shape, height and flowering time can be significantly different – which is why the idea of my snowdrop hunt appeals.
      Finally I did indeed start my blog after coming across yours all those years ago and thinking (whilst searching for evidence on whether snowdrops are thermogenic), ” WOW this is great, and really interesting. Maybe I should have a go!”.
      But I have measured 2 degree C differences with a point and shoot laser thermometer. It’s difficult to get good pics of it though! Click here for some pics of it on Crocus flowers…
      https://thegardenimpressionists.com/2015/02/04/candles-in-the-wind-the-delights-of-snow-crocuses-and-spiral-conundrum-reprise/

      Finally I don’t know if Naomi takes pics with a mirror…but I found it great for showing all the tiny flowers inside some (….maybe the warmest? ) of the snowdrops
      Best wishes
      Julian

  2. Oh my goodness Julian, this is a packed post and one I had to save to properly read and digest. We very rarely have temperatures down to -7c, but I am going to monitor this. I love the photo, under the text, “I’m certainly up for another ice challenge. But we’d need some more proper winter weather to ever confirm this…” Where was this photo taken?
    Do you think that the snowdrops could also be pollinated by micro moths and beetles as well as small flies and bees. That way there may be chance of winter pollination. The low light levels for photography are a challenge at this time of year, I did appreciate the extra note there. The bar code was well over my head, but will try to understand what that means! Good luck with your snowdrop research, I wish I could understand the fuss and much prefer a crocus any day. For the purpose of your ice spike research I hope you have some freezing temperatures, otherwise I hope you have some sunshine.

    • Hello Julie,
      Thanks for the comment…it was a bit of a mammoth, so well done for even trying to read it all. The first pic comes from my post RIP RAP Riddle (?), and was my effort at making an ice tower, as a play on Orthanc, to go with the words of the post …and I had a nice sunrise to take 2 photos on our wall before it fell over and smashed!
      Anything is possible with the pollination. All I can say is that I’ve spent ages over the years looking at/into snowdrop flowers and never seen either a micromoth or beetle. But of course that is just not up here. Actually I don’t think I’ve ever found any micromoths in January or February, but I’d need to check my moth diary pages …. just done so, and now I remember from the photo, that I on a single occasion found a Diamond back micro moth in a sunny Crocus flower in late February – but these are immigrant moths, so it was probably blown in on an early and warm Southerly wind. I think that their very small size mitigates against micromoths being on the wing in any numbers until the temperatures warm up a bit. I sometimes find one or two when I’m messing around in the woodstore, but I think they’re essentially inactive – unlike those small flies, which are amazingly common, and inside the snowdrop flowers.
      I do very much take your point about snowdrops/Crocus, but actually up here white flowers look great under grey skies, and they do have the merit of being much less likely to suffer either rodent or slug damage than Crocus. My real preference is the Cyclamen coum, but as you might have gathered from the earlier comments, I think much of the galanthomania is commercially driven – so more fool the galanthophiles ( hands up to me as well) for ever succumbing. If you could easily clone or twin scale Cyclamen coum, then I’m sure they’d have created just the same enthusiasm. But since you can’t, there’s not the commercial incentive to constantly promote individual variants
      I suspect we’re out of the optimum ice spike conditions for this year, but you never know!
      BW
      Julian

      • Of course re the moths, I had not thought that through properly. The ice tower is quite beautiful, I can imagine the moment it smashed though. I think its the enormous interest in snowdrops which puts me off a bit, I like an underdog. But will try to be open minded.

  3. Not much hope of an ice sculpture here unless the jet stream moves and we get a northerl easterly air flow. I like the concept of ice sculptures an interesting mixture of complex science and environmental forces.
    I’ve not had much success with even G. nivalis in the garden. Fine in pots – so I think it must be the soil. I’ve prepared a new shade bed, with enriched soil and a bark mulch, so it will be interesting to see if they survive. They also appear much later here, the first leaves are just showing. I doubt if it is a temperature effect, as they’re bulbs it’s not day length and they were imported from my Worcestershire garden so it is not a local clone! If they flower, I’ll definitely try the mirror trick to look for the pollinators.
    Christine

    • The timing of flowering of different nivalis clones is really interesting, and very variable – even in this locality. We have one from a vigorous North facing slope, which in situ was always very late into flower. With us on a South facing slope, its equally late. I’m certain that lots of deciduous tree/shrub leaf mould is really beneficial, or even critical – though that’s probably not an easy material for you to source where you are? I wonder if anyone supplies leaf mould commercially? And if not, why not?
      The mirror trick really is quite fun and easy – I mean to try it on the Cyclamen coum, if/when we get another dry day!
      Best wishes
      Julian

  4. I’m so glad you did not throw your Christmas cracker mirror away! I loved the mirror images of the insides of the snowdrops. I’ve had to come to the U.K. to help out the family but I am already thinking of trying to catch bumble bees on the inside of Hellebores with a mirror. The ice spike formation is very interesting but I’d just as soon look at your photographs than live through minus 7 degree temperatures. On the other hand I would love to live with those carpets of snowdrops and crocus. Amelia

    • Thanks Amelia. I trust that you’re not venturing over to this side of the UK, or you’d be very welcome to come and have a look at the flowers in real life, though right now, they’re being thoroughly drenched. Again. Minus 7 seems strangely appealing by comparison… The mirror trick is definitely worth experimenting with – ideally it would be an advantage to have a helper – I managed these pics on my own, and it’s surprisingly tricky to coordinate movements of a small mirror on the end of a long stick in one hand, whilst holding the camera and using the viewfinder/shutter release in the other! But Hellebores and bumblebees would be perfect subjects. Still too early for us to have seen any up here,
      BW
      Julian

      • I would really love to see the garden but the family are all in the south east and this visit will mean I am totally confined helping my daughter who has hurt her back 🙁 I am looking forward to getting back to the garden but will miss my granddaughter.

  5. Thanks for this post, I especially enjoyed your snowdrops. My impression was that snowdrops were introduced later than Roman times although quite when seems to be unclear. Culpeper makes no mention, Gerard, in one of the earliest written references, refers to the flower as a bulbous violet in the first edition of his Herbal (1597) saying it is an introduced garden plant and Shakespeare makes no mention.

    To complicate matters, however, I came across this reference to “native” snowdrops near the Welsh border: http://archive.spectator.co.uk/article/31st-january-1947/8/a-candle-to-candlemas

    • Hello Philip,
      Glad you liked it. Like you, I’d until recently assumed snowdrops were introduced around 1500-1600. After all the snowdrop ‘bible’ (Bishop, Davis and Grimshaw) explores this issue and comes up with this answer – mainly linked to the lack of any previous literary mentions. And yet…. Naomi Slade mentions in her book (and talk) that the owner of Welford Park is pretty certain that her amazing displays date back to the time of a Norman monastery on site, and has plausible reasons. (see link below) .And why might the Romans not have brought a few over on their forays into the UK? After all our soldiers brought some of the ‘newer’ species back from the Crimea? So an interesting story to investigate. Whether DNA coding could be used in some way to trace back lineages, I just don’t know yet. Follow this link for more :
      http://www.welfordpark.co.uk/snowdrops
      Best wishes
      Julian

    • Thanks Inese. I wonder if you’ve ever seen any ice vases or ice spikes?…I’ve just seen another this last week in our Bristol Blue bowl…will post pics, sometime, but I’m beginning to think that they might be another reflection of the unusual micro climate around here?
      Best wishes
      Julian

      • Julian, no sign of ice here in Ireland. May be somewhere in the mountains, but not where I live. However, I remember seeing a lot of interesting shapes and different kinds of ice when I was young. Sure I remember cup-shaped ice. I grew up near the lake, and I remember stalks of weeds surrounded with such ice cups.

  6. Yes, Inese, I have similar memories from walks into the mountains North of here, 35 years ago and seeing – and taking pics, of amazing clusters of ice , built up on the banks of streams and lakes …
    But these spikes without any obvious base, continue to amaze me!
    BW
    Julian

  7. The ice spike phenomenon now makes perfect sense – thank you for a great explanation!
    I was astonished at the 2 deg C temperature difference within the snowdrop flower; they really are incredible little plants and I’m starting to see them in a whole new light. By the way, the mirror trick (so blindingly obvious – but not to me!), is a brilliant idea and something I may well have a play with – no patent issues I assume?! 😀
    Good luck with your ‘Historic Welsh Snowdrop Hunt’ – I look forward to seeing how it progresses.

    • More news on the ice spikes next time… and my ice crystals. The mirror trick is a great idea isn’t it. Certainly not my own, and certainly no patents, but I think could be usefully used in other photographic situations – particularly with a bigger mirror maybe? Great for getting sky into the background without grubby fingers moving flowers around! And an extra pair of hands to hold the mirror would be useful perhaps.
      Had an amazing snowdrop hunt day today .Several locations and wonderful stories, which is going to be the biggest fun part of all this, I think..and today will probably totally eclipse the sight of us and the garden on TV tomorrow! Some more info on this in due course, methinks
      Best wishes
      Julian

  8. Pingback: Eruption Week. | thegardenimpressionists

  9. Pingback: Big Fish and Creative Synergies; Ice Spike, Glass Eel; and Splitting Lilies. | thegardenimpressionists

Comments are closed.